Family Outcome SNV Mode of Inheritance Highest Impact Gene Associated Diseases
Family 1 fetal death chr3:63912887:C:A Autosomal Dominant Missense ATXN7 Spinocerebellar ataxia 7
fetal death chr3:63912887:C:A
fetal death chr19:17314331:C:A Autosomal Dominant Splice region DDA1 -
stillbirth chr14:95129520:ATTTTCTCTAGTTTCTGAATC:A de novo Frameshift DICER1 Embryonal; Global developmental delay
stillbirth chr10:419184:G:A Autosomal Dominant Missense DIP2C -
fetal death
fetal death
fetal death chr9:83970202:G:A de novo Stop gained HNRNPK Au-Kline Syndrome
fetal death chr10:17840773:C:T Autosomal Dominant Missense MRC1 Gaucher’s Disease
stillbirth chr3:88139246:C:T de novo Missense ZNF654 -
Family 4 fetal death chrX:108591181:C:A X-linked recessive Missense COL4A5 Alport syndrome 1
fetal death chr11:117458790:G:A Autosomal Dominant Missense DSCAML1 Down Syndrome
fetal death chr5:128335211:TAGCAGAGGCAGCGATACTCTCCAGGAATGTTGGTACACTGGCCGCCATCAC:T de novo In-frame Deletion FBN2 Congenital contractual arachnodactyly
fetal death chr8:41977214:C:T de novo Missense KAT6A Mental retardation, autosomal dominant 32
fetal death chr9:33062105:CTGCCTTGCCTCGAAACAAATCTATGGTCATACCAGGAGGAAGCAATCCCTGATGCTGCTGCCACTTCAG:C de novo In-frame Deletion SMU1 -
Family 3 Embryonic loss chr7:140739949:GGA:G de novo Splice region BRAF Noonan syndrome 7
stillbirth chr6:36200959:G:A de novo Missense BRPF3 -
Embryonic loss chr17:47171999:C:T de novo Missense CDC27 -
fetal death chr5:180603262:G:A Autosomal Dominant Missense FLT4 Congenital heart defects
Embryonic loss chr15:63774800:G:T de novo Stop gained HERC1 Macrocephaly
Embryonic loss chr15:63774801:A:C de novo Missense
Embryonic loss chr15:63774805:C:CT de novo Frameshift
Embryonic loss chr5:150134013:TAG:T de novo Splice region PDGFRB Kosaki overgrowth syndrome
Embryonic loss chr15:43766828:TTGGAGAGCACTGC:T de novo Frameshift PDIA3 Prion Disease
Embryonic loss chr8:140668348:G:A de novo Missense PTK2 Malignant Astrocytoma; Ovarian Cancer
Embryonic loss chr9:127069303:G:A de novo Missense RALGPS1 Developmental And Epileptic Encephalopathy 4; Uterine Carcinosarcoma
stillbirth chr2:11249767:G:A de novo Missense ROCK2 Ureteral Obstruction
Embryonic loss chr12:27309142:G:A de novo Missense STK38L Macular Degeneration
stillbirth chr6:147316370:TC:T de novo Frameshift STXBP5 Von Willebrand Disease
stillbirth chr17:29507963:G:A de novo Missense TAOK1 Developmental Delay With Or Without Intellectual Impairment
fetal death chr2:169994355:A:AG de novo Frameshift UBR3 -
stillbirth chr2:61227175:TCTTCTTCTTCCC:T de novo In-frame Deletion USP34 -