2.6.2 High throughput analysis of AM fungi
Total DNA was extracted from mixed soil (0.5 g) using Fast DNA® Spin Kit for Soil. And then AM fungus-specific primers AML1 and AML2 were selected as the first round of primers ((Lee, Lee , & Young, 2008), AMV4.5NF (AAGCTCGTAGTTGAATTTCG) and AMDGR (CCCAACTATCCCTAT-TAATCAT) were selected as the second round of primers for amplification with the nested PCR amplification method ((Sato, Suyama, Saito , & Sugawara, 2005). The PCR amplification products were detected and recovered by 2% agarose gel electrophoresis, and Illumina’s MiseqPE300 platform was used for sequencing. Raw sequences were uploaded to the NCBI Sequence Read Archive (SRP426700).